ID: 1202993963

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:38253-38275
Sequence CCTAATATCCAGACTCCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202993960_1202993963 21 Left 1202993960 16_KI270728v1_random:38209-38231 CCAGAATGGGAGGAGATATTCAC No data
Right 1202993963 16_KI270728v1_random:38253-38275 CCTAATATCCAGACTCCATAGGG No data
1202993959_1202993963 24 Left 1202993959 16_KI270728v1_random:38206-38228 CCTCCAGAATGGGAGGAGATATT No data
Right 1202993963 16_KI270728v1_random:38253-38275 CCTAATATCCAGACTCCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202993963 Original CRISPR CCTAATATCCAGACTCCATA GGG Intergenic
No off target data available for this crispr