ID: 1202996082

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:111753-111775
Sequence CGACATAAACATACAGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202996082_1202996085 13 Left 1202996082 16_KI270728v1_random:111753-111775 CCCAGCTCTGTATGTTTATGTCG No data
Right 1202996085 16_KI270728v1_random:111789-111811 CAACCATTTGTTTATTAGGATGG No data
1202996082_1202996084 9 Left 1202996082 16_KI270728v1_random:111753-111775 CCCAGCTCTGTATGTTTATGTCG No data
Right 1202996084 16_KI270728v1_random:111785-111807 AGAGCAACCATTTGTTTATTAGG No data
1202996082_1202996087 22 Left 1202996082 16_KI270728v1_random:111753-111775 CCCAGCTCTGTATGTTTATGTCG No data
Right 1202996087 16_KI270728v1_random:111798-111820 GTTTATTAGGATGGCCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202996082 Original CRISPR CGACATAAACATACAGAGCT GGG (reversed) Intergenic
No off target data available for this crispr