ID: 1203001050

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:164558-164580
Sequence GGCCAGTGGGAACAGCTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203001050_1203001055 -7 Left 1203001050 16_KI270728v1_random:164558-164580 CCATGGAGCTGTTCCCACTGGCC No data
Right 1203001055 16_KI270728v1_random:164574-164596 ACTGGCCCCTAGCTAGAGGTGGG No data
1203001050_1203001060 21 Left 1203001050 16_KI270728v1_random:164558-164580 CCATGGAGCTGTTCCCACTGGCC No data
Right 1203001060 16_KI270728v1_random:164602-164624 GACTTTGAAACATGAACAAATGG No data
1203001050_1203001054 -8 Left 1203001050 16_KI270728v1_random:164558-164580 CCATGGAGCTGTTCCCACTGGCC No data
Right 1203001054 16_KI270728v1_random:164573-164595 CACTGGCCCCTAGCTAGAGGTGG No data
1203001050_1203001058 -1 Left 1203001050 16_KI270728v1_random:164558-164580 CCATGGAGCTGTTCCCACTGGCC No data
Right 1203001058 16_KI270728v1_random:164580-164602 CCCTAGCTAGAGGTGGGTGTAGG No data
1203001050_1203001061 27 Left 1203001050 16_KI270728v1_random:164558-164580 CCATGGAGCTGTTCCCACTGGCC No data
Right 1203001061 16_KI270728v1_random:164608-164630 GAAACATGAACAAATGGAGCTGG No data
1203001050_1203001062 28 Left 1203001050 16_KI270728v1_random:164558-164580 CCATGGAGCTGTTCCCACTGGCC No data
Right 1203001062 16_KI270728v1_random:164609-164631 AAACATGAACAAATGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203001050 Original CRISPR GGCCAGTGGGAACAGCTCCA TGG (reversed) Intergenic
No off target data available for this crispr