ID: 1203001056 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16_KI270728v1_random:164579-164601 |
Sequence | CTACACCCACCTCTAGCTAG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 7 Related Crispr Pairs
Show Crispr PairsNote: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1203001056 | Original CRISPR | CTACACCCACCTCTAGCTAG GGG (reversed) | Intergenic | ||
No off target data available for this crispr |