ID: 1203001057

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:164580-164602
Sequence CCTACACCCACCTCTAGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203001057_1203001061 5 Left 1203001057 16_KI270728v1_random:164580-164602 CCCTAGCTAGAGGTGGGTGTAGG No data
Right 1203001061 16_KI270728v1_random:164608-164630 GAAACATGAACAAATGGAGCTGG No data
1203001057_1203001062 6 Left 1203001057 16_KI270728v1_random:164580-164602 CCCTAGCTAGAGGTGGGTGTAGG No data
Right 1203001062 16_KI270728v1_random:164609-164631 AAACATGAACAAATGGAGCTGGG No data
1203001057_1203001065 19 Left 1203001057 16_KI270728v1_random:164580-164602 CCCTAGCTAGAGGTGGGTGTAGG No data
Right 1203001065 16_KI270728v1_random:164622-164644 TGGAGCTGGGATGGCAATGGCGG No data
1203001057_1203001060 -1 Left 1203001057 16_KI270728v1_random:164580-164602 CCCTAGCTAGAGGTGGGTGTAGG No data
Right 1203001060 16_KI270728v1_random:164602-164624 GACTTTGAAACATGAACAAATGG No data
1203001057_1203001064 16 Left 1203001057 16_KI270728v1_random:164580-164602 CCCTAGCTAGAGGTGGGTGTAGG No data
Right 1203001064 16_KI270728v1_random:164619-164641 AAATGGAGCTGGGATGGCAATGG No data
1203001057_1203001063 10 Left 1203001057 16_KI270728v1_random:164580-164602 CCCTAGCTAGAGGTGGGTGTAGG No data
Right 1203001063 16_KI270728v1_random:164613-164635 ATGAACAAATGGAGCTGGGATGG No data
1203001057_1203001066 20 Left 1203001057 16_KI270728v1_random:164580-164602 CCCTAGCTAGAGGTGGGTGTAGG No data
Right 1203001066 16_KI270728v1_random:164623-164645 GGAGCTGGGATGGCAATGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203001057 Original CRISPR CCTACACCCACCTCTAGCTA GGG (reversed) Intergenic
No off target data available for this crispr