ID: 1203001059

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:164581-164603
Sequence TCCTACACCCACCTCTAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203001059_1203001060 -2 Left 1203001059 16_KI270728v1_random:164581-164603 CCTAGCTAGAGGTGGGTGTAGGA No data
Right 1203001060 16_KI270728v1_random:164602-164624 GACTTTGAAACATGAACAAATGG No data
1203001059_1203001065 18 Left 1203001059 16_KI270728v1_random:164581-164603 CCTAGCTAGAGGTGGGTGTAGGA No data
Right 1203001065 16_KI270728v1_random:164622-164644 TGGAGCTGGGATGGCAATGGCGG No data
1203001059_1203001062 5 Left 1203001059 16_KI270728v1_random:164581-164603 CCTAGCTAGAGGTGGGTGTAGGA No data
Right 1203001062 16_KI270728v1_random:164609-164631 AAACATGAACAAATGGAGCTGGG No data
1203001059_1203001061 4 Left 1203001059 16_KI270728v1_random:164581-164603 CCTAGCTAGAGGTGGGTGTAGGA No data
Right 1203001061 16_KI270728v1_random:164608-164630 GAAACATGAACAAATGGAGCTGG No data
1203001059_1203001063 9 Left 1203001059 16_KI270728v1_random:164581-164603 CCTAGCTAGAGGTGGGTGTAGGA No data
Right 1203001063 16_KI270728v1_random:164613-164635 ATGAACAAATGGAGCTGGGATGG No data
1203001059_1203001066 19 Left 1203001059 16_KI270728v1_random:164581-164603 CCTAGCTAGAGGTGGGTGTAGGA No data
Right 1203001066 16_KI270728v1_random:164623-164645 GGAGCTGGGATGGCAATGGCGGG No data
1203001059_1203001064 15 Left 1203001059 16_KI270728v1_random:164581-164603 CCTAGCTAGAGGTGGGTGTAGGA No data
Right 1203001064 16_KI270728v1_random:164619-164641 AAATGGAGCTGGGATGGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203001059 Original CRISPR TCCTACACCCACCTCTAGCT AGG (reversed) Intergenic
No off target data available for this crispr