ID: 1203001062

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:164609-164631
Sequence AAACATGAACAAATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203001052_1203001062 15 Left 1203001052 16_KI270728v1_random:164571-164593 CCCACTGGCCCCTAGCTAGAGGT No data
Right 1203001062 16_KI270728v1_random:164609-164631 AAACATGAACAAATGGAGCTGGG No data
1203001057_1203001062 6 Left 1203001057 16_KI270728v1_random:164580-164602 CCCTAGCTAGAGGTGGGTGTAGG No data
Right 1203001062 16_KI270728v1_random:164609-164631 AAACATGAACAAATGGAGCTGGG No data
1203001059_1203001062 5 Left 1203001059 16_KI270728v1_random:164581-164603 CCTAGCTAGAGGTGGGTGTAGGA No data
Right 1203001062 16_KI270728v1_random:164609-164631 AAACATGAACAAATGGAGCTGGG No data
1203001056_1203001062 7 Left 1203001056 16_KI270728v1_random:164579-164601 CCCCTAGCTAGAGGTGGGTGTAG No data
Right 1203001062 16_KI270728v1_random:164609-164631 AAACATGAACAAATGGAGCTGGG No data
1203001053_1203001062 14 Left 1203001053 16_KI270728v1_random:164572-164594 CCACTGGCCCCTAGCTAGAGGTG No data
Right 1203001062 16_KI270728v1_random:164609-164631 AAACATGAACAAATGGAGCTGGG No data
1203001050_1203001062 28 Left 1203001050 16_KI270728v1_random:164558-164580 CCATGGAGCTGTTCCCACTGGCC No data
Right 1203001062 16_KI270728v1_random:164609-164631 AAACATGAACAAATGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203001062 Original CRISPR AAACATGAACAAATGGAGCT GGG Intergenic
No off target data available for this crispr