ID: 1203001663

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:168926-168948
Sequence CCGCGTCCGCCTCGAGCTAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203001663_1203001667 -9 Left 1203001663 16_KI270728v1_random:168926-168948 CCGTTAGCTCGAGGCGGACGCGG No data
Right 1203001667 16_KI270728v1_random:168940-168962 CGGACGCGGCCCGGACCCGGTGG No data
1203001663_1203001668 -3 Left 1203001663 16_KI270728v1_random:168926-168948 CCGTTAGCTCGAGGCGGACGCGG No data
Right 1203001668 16_KI270728v1_random:168946-168968 CGGCCCGGACCCGGTGGATGTGG No data
1203001663_1203001673 15 Left 1203001663 16_KI270728v1_random:168926-168948 CCGTTAGCTCGAGGCGGACGCGG No data
Right 1203001673 16_KI270728v1_random:168964-168986 TGTGGAGCAGTCGCCGCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203001663 Original CRISPR CCGCGTCCGCCTCGAGCTAA CGG (reversed) Intergenic
No off target data available for this crispr