ID: 1203001669

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:168949-168971
Sequence GCTCCACATCCACCGGGTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203001669_1203001676 11 Left 1203001669 16_KI270728v1_random:168949-168971 CCCGGACCCGGTGGATGTGGAGC No data
Right 1203001676 16_KI270728v1_random:168983-169005 CCGGCGCCCAAGCCGACCCCAGG No data
1203001669_1203001673 -8 Left 1203001669 16_KI270728v1_random:168949-168971 CCCGGACCCGGTGGATGTGGAGC No data
Right 1203001673 16_KI270728v1_random:168964-168986 TGTGGAGCAGTCGCCGCTGCCGG No data
1203001669_1203001677 12 Left 1203001669 16_KI270728v1_random:168949-168971 CCCGGACCCGGTGGATGTGGAGC No data
Right 1203001677 16_KI270728v1_random:168984-169006 CGGCGCCCAAGCCGACCCCAGGG No data
1203001669_1203001682 27 Left 1203001669 16_KI270728v1_random:168949-168971 CCCGGACCCGGTGGATGTGGAGC No data
Right 1203001682 16_KI270728v1_random:168999-169021 CCCCAGGGCCGACCCCCGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203001669 Original CRISPR GCTCCACATCCACCGGGTCC GGG (reversed) Intergenic
No off target data available for this crispr