ID: 1203001673

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:168964-168986
Sequence TGTGGAGCAGTCGCCGCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203001670_1203001673 -9 Left 1203001670 16_KI270728v1_random:168950-168972 CCGGACCCGGTGGATGTGGAGCA No data
Right 1203001673 16_KI270728v1_random:168964-168986 TGTGGAGCAGTCGCCGCTGCCGG No data
1203001660_1203001673 29 Left 1203001660 16_KI270728v1_random:168912-168934 CCTAGCTGGCGGGACCGTTAGCT No data
Right 1203001673 16_KI270728v1_random:168964-168986 TGTGGAGCAGTCGCCGCTGCCGG No data
1203001663_1203001673 15 Left 1203001663 16_KI270728v1_random:168926-168948 CCGTTAGCTCGAGGCGGACGCGG No data
Right 1203001673 16_KI270728v1_random:168964-168986 TGTGGAGCAGTCGCCGCTGCCGG No data
1203001669_1203001673 -8 Left 1203001669 16_KI270728v1_random:168949-168971 CCCGGACCCGGTGGATGTGGAGC No data
Right 1203001673 16_KI270728v1_random:168964-168986 TGTGGAGCAGTCGCCGCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203001673 Original CRISPR TGTGGAGCAGTCGCCGCTGC CGG Intergenic
No off target data available for this crispr