ID: 1203006115

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:203016-203038
Sequence AAACATGAACAAATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203006104_1203006115 28 Left 1203006104 16_KI270728v1_random:202965-202987 CCGTGGAGCGGTTCCCACTGGCC No data
Right 1203006115 16_KI270728v1_random:203016-203038 AAACATGAACAAATGGAGCTGGG No data
1203006110_1203006115 7 Left 1203006110 16_KI270728v1_random:202986-203008 CCCCTAGCTAGAGGTGGGTGTAA No data
Right 1203006115 16_KI270728v1_random:203016-203038 AAACATGAACAAATGGAGCTGGG No data
1203006107_1203006115 14 Left 1203006107 16_KI270728v1_random:202979-203001 CCACTGGCCCCTAGCTAGAGGTG No data
Right 1203006115 16_KI270728v1_random:203016-203038 AAACATGAACAAATGGAGCTGGG No data
1203006111_1203006115 6 Left 1203006111 16_KI270728v1_random:202987-203009 CCCTAGCTAGAGGTGGGTGTAAG No data
Right 1203006115 16_KI270728v1_random:203016-203038 AAACATGAACAAATGGAGCTGGG No data
1203006112_1203006115 5 Left 1203006112 16_KI270728v1_random:202988-203010 CCTAGCTAGAGGTGGGTGTAAGA No data
Right 1203006115 16_KI270728v1_random:203016-203038 AAACATGAACAAATGGAGCTGGG No data
1203006106_1203006115 15 Left 1203006106 16_KI270728v1_random:202978-203000 CCCACTGGCCCCTAGCTAGAGGT No data
Right 1203006115 16_KI270728v1_random:203016-203038 AAACATGAACAAATGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203006115 Original CRISPR AAACATGAACAAATGGAGCT GGG Intergenic
No off target data available for this crispr