ID: 1203006713

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:207377-207399
Sequence TATGGAGCAATCGCCGCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203006703_1203006713 15 Left 1203006703 16_KI270728v1_random:207339-207361 CCGTTAGATCGAGGCGGATGCGG No data
Right 1203006713 16_KI270728v1_random:207377-207399 TATGGAGCAATCGCCGCCGCTGG No data
1203006709_1203006713 -9 Left 1203006709 16_KI270728v1_random:207363-207385 CCGGACCCCGTGGATATGGAGCA No data
Right 1203006713 16_KI270728v1_random:207377-207399 TATGGAGCAATCGCCGCCGCTGG No data
1203006700_1203006713 29 Left 1203006700 16_KI270728v1_random:207325-207347 CCTAGCTGGCGGGACCGTTAGAT No data
Right 1203006713 16_KI270728v1_random:207377-207399 TATGGAGCAATCGCCGCCGCTGG No data
1203006708_1203006713 -8 Left 1203006708 16_KI270728v1_random:207362-207384 CCCGGACCCCGTGGATATGGAGC No data
Right 1203006713 16_KI270728v1_random:207377-207399 TATGGAGCAATCGCCGCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203006713 Original CRISPR TATGGAGCAATCGCCGCCGC TGG Intergenic
No off target data available for this crispr