ID: 1203011425

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:243852-243874
Sequence CCTAATATCCAGACTCCATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203011425_1203011428 21 Left 1203011425 16_KI270728v1_random:243852-243874 CCCTATGGAGTCTGGATATTAGG No data
Right 1203011428 16_KI270728v1_random:243896-243918 GTGAATATCTCCTCCCATTCTGG No data
1203011425_1203011429 24 Left 1203011425 16_KI270728v1_random:243852-243874 CCCTATGGAGTCTGGATATTAGG No data
Right 1203011429 16_KI270728v1_random:243899-243921 AATATCTCCTCCCATTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203011425 Original CRISPR CCTAATATCCAGACTCCATA GGG (reversed) Intergenic
No off target data available for this crispr