ID: 1203014468

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:340172-340194
Sequence CTGAGAAACCACTTTGTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203014468_1203014470 5 Left 1203014468 16_KI270728v1_random:340172-340194 CCAATCACAAAGTGGTTTCTCAG No data
Right 1203014470 16_KI270728v1_random:340200-340222 TTCCTTCTAGTTTTCATTCTGGG No data
1203014468_1203014469 4 Left 1203014468 16_KI270728v1_random:340172-340194 CCAATCACAAAGTGGTTTCTCAG No data
Right 1203014469 16_KI270728v1_random:340199-340221 CTTCCTTCTAGTTTTCATTCTGG No data
1203014468_1203014472 28 Left 1203014468 16_KI270728v1_random:340172-340194 CCAATCACAAAGTGGTTTCTCAG No data
Right 1203014472 16_KI270728v1_random:340223-340245 ATGTTCACTTTTTTCAACGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203014468 Original CRISPR CTGAGAAACCACTTTGTGAT TGG (reversed) Intergenic