ID: 1203014469

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:340199-340221
Sequence CTTCCTTCTAGTTTTCATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203014468_1203014469 4 Left 1203014468 16_KI270728v1_random:340172-340194 CCAATCACAAAGTGGTTTCTCAG No data
Right 1203014469 16_KI270728v1_random:340199-340221 CTTCCTTCTAGTTTTCATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203014469 Original CRISPR CTTCCTTCTAGTTTTCATTC TGG Intergenic