ID: 1203014472

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:340223-340245
Sequence ATGTTCACTTTTTTCAACGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203014468_1203014472 28 Left 1203014468 16_KI270728v1_random:340172-340194 CCAATCACAAAGTGGTTTCTCAG No data
Right 1203014472 16_KI270728v1_random:340223-340245 ATGTTCACTTTTTTCAACGTAGG No data
1203014471_1203014472 -2 Left 1203014471 16_KI270728v1_random:340202-340224 CCTTCTAGTTTTCATTCTGGGAT No data
Right 1203014472 16_KI270728v1_random:340223-340245 ATGTTCACTTTTTTCAACGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203014472 Original CRISPR ATGTTCACTTTTTTCAACGT AGG Intergenic