ID: 1203016236

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:355364-355386
Sequence TTCCCAGCTCAGTGCCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203016228_1203016236 25 Left 1203016228 16_KI270728v1_random:355316-355338 CCTGACCACACGGGCCTCTGCTT No data
Right 1203016236 16_KI270728v1_random:355364-355386 TTCCCAGCTCAGTGCCAAAGAGG No data
1203016232_1203016236 11 Left 1203016232 16_KI270728v1_random:355330-355352 CCTCTGCTTGCTAGCCGGGAGTG No data
Right 1203016236 16_KI270728v1_random:355364-355386 TTCCCAGCTCAGTGCCAAAGAGG No data
1203016227_1203016236 28 Left 1203016227 16_KI270728v1_random:355313-355335 CCACCTGACCACACGGGCCTCTG No data
Right 1203016236 16_KI270728v1_random:355364-355386 TTCCCAGCTCAGTGCCAAAGAGG No data
1203016234_1203016236 -3 Left 1203016234 16_KI270728v1_random:355344-355366 CCGGGAGTGCGGACACCATGTTC No data
Right 1203016236 16_KI270728v1_random:355364-355386 TTCCCAGCTCAGTGCCAAAGAGG No data
1203016229_1203016236 20 Left 1203016229 16_KI270728v1_random:355321-355343 CCACACGGGCCTCTGCTTGCTAG No data
Right 1203016236 16_KI270728v1_random:355364-355386 TTCCCAGCTCAGTGCCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203016236 Original CRISPR TTCCCAGCTCAGTGCCAAAG AGG Intergenic
No off target data available for this crispr