ID: 1203016290

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:355566-355588
Sequence CTGCGGGTCTTGGGGTGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203016282_1203016290 4 Left 1203016282 16_KI270728v1_random:355539-355561 CCCTGCCTCAGAGTCTGGTGGTG No data
Right 1203016290 16_KI270728v1_random:355566-355588 CTGCGGGTCTTGGGGTGAGATGG No data
1203016277_1203016290 28 Left 1203016277 16_KI270728v1_random:355515-355537 CCATTGGCAAATGCAGTCCTTCC No data
Right 1203016290 16_KI270728v1_random:355566-355588 CTGCGGGTCTTGGGGTGAGATGG No data
1203016284_1203016290 -1 Left 1203016284 16_KI270728v1_random:355544-355566 CCTCAGAGTCTGGTGGTGTCTGC No data
Right 1203016290 16_KI270728v1_random:355566-355588 CTGCGGGTCTTGGGGTGAGATGG No data
1203016283_1203016290 3 Left 1203016283 16_KI270728v1_random:355540-355562 CCTGCCTCAGAGTCTGGTGGTGT No data
Right 1203016290 16_KI270728v1_random:355566-355588 CTGCGGGTCTTGGGGTGAGATGG No data
1203016280_1203016290 7 Left 1203016280 16_KI270728v1_random:355536-355558 CCTCCCTGCCTCAGAGTCTGGTG No data
Right 1203016290 16_KI270728v1_random:355566-355588 CTGCGGGTCTTGGGGTGAGATGG No data
1203016278_1203016290 11 Left 1203016278 16_KI270728v1_random:355532-355554 CCTTCCTCCCTGCCTCAGAGTCT No data
Right 1203016290 16_KI270728v1_random:355566-355588 CTGCGGGTCTTGGGGTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203016290 Original CRISPR CTGCGGGTCTTGGGGTGAGA TGG Intergenic
No off target data available for this crispr