ID: 1203017166

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:362043-362065
Sequence CTGGCTTTCGGCTGGTACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203017166_1203017171 -10 Left 1203017166 16_KI270728v1_random:362043-362065 CCCTAGTACCAGCCGAAAGCCAG No data
Right 1203017171 16_KI270728v1_random:362056-362078 CGAAAGCCAGGTAGACCTGCTGG No data
1203017166_1203017172 -9 Left 1203017166 16_KI270728v1_random:362043-362065 CCCTAGTACCAGCCGAAAGCCAG No data
Right 1203017172 16_KI270728v1_random:362057-362079 GAAAGCCAGGTAGACCTGCTGGG No data
1203017166_1203017173 -6 Left 1203017166 16_KI270728v1_random:362043-362065 CCCTAGTACCAGCCGAAAGCCAG No data
Right 1203017173 16_KI270728v1_random:362060-362082 AGCCAGGTAGACCTGCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203017166 Original CRISPR CTGGCTTTCGGCTGGTACTA GGG (reversed) Intergenic
No off target data available for this crispr