ID: 1203022769

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:424095-424117
Sequence CGACATAAACATACAGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203022769_1203022772 13 Left 1203022769 16_KI270728v1_random:424095-424117 CCCAGCTCTGTATGTTTATGTCG No data
Right 1203022772 16_KI270728v1_random:424131-424153 CAACCATTTGTTTATTAGGATGG No data
1203022769_1203022774 22 Left 1203022769 16_KI270728v1_random:424095-424117 CCCAGCTCTGTATGTTTATGTCG No data
Right 1203022774 16_KI270728v1_random:424140-424162 GTTTATTAGGATGGCCAAAAAGG No data
1203022769_1203022771 9 Left 1203022769 16_KI270728v1_random:424095-424117 CCCAGCTCTGTATGTTTATGTCG No data
Right 1203022771 16_KI270728v1_random:424127-424149 AGAGCAACCATTTGTTTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203022769 Original CRISPR CGACATAAACATACAGAGCT GGG (reversed) Intergenic
No off target data available for this crispr