ID: 1203025535

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:507448-507470
Sequence CTTCTATCCAGTTTTTATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203025534_1203025535 7 Left 1203025534 16_KI270728v1_random:507418-507440 CCACTTATCACAAAGCATTTTGA No data
Right 1203025535 16_KI270728v1_random:507448-507470 CTTCTATCCAGTTTTTATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203025535 Original CRISPR CTTCTATCCAGTTTTTATGT AGG Intergenic
No off target data available for this crispr