ID: 1203029260

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:559421-559443
Sequence TTGGATATTCACTTCACCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203029260_1203029265 24 Left 1203029260 16_KI270728v1_random:559421-559443 CCAATGGTGAAGTGAATATCCAA No data
Right 1203029265 16_KI270728v1_random:559468-559490 ATGAGAAATCACTTTGTGATGGG No data
1203029260_1203029264 23 Left 1203029260 16_KI270728v1_random:559421-559443 CCAATGGTGAAGTGAATATCCAA No data
Right 1203029264 16_KI270728v1_random:559467-559489 TATGAGAAATCACTTTGTGATGG No data
1203029260_1203029262 -6 Left 1203029260 16_KI270728v1_random:559421-559443 CCAATGGTGAAGTGAATATCCAA No data
Right 1203029262 16_KI270728v1_random:559438-559460 ATCCAAGGATAAAAACTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203029260 Original CRISPR TTGGATATTCACTTCACCAT TGG (reversed) Intergenic