ID: 1203029263

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:559440-559462
Sequence TTCCTTCTAGTTTTTATCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203029263_1203029264 4 Left 1203029263 16_KI270728v1_random:559440-559462 CCAAGGATAAAAACTAGAAGGAA No data
Right 1203029264 16_KI270728v1_random:559467-559489 TATGAGAAATCACTTTGTGATGG No data
1203029263_1203029265 5 Left 1203029263 16_KI270728v1_random:559440-559462 CCAAGGATAAAAACTAGAAGGAA No data
Right 1203029265 16_KI270728v1_random:559468-559490 ATGAGAAATCACTTTGTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203029263 Original CRISPR TTCCTTCTAGTTTTTATCCT TGG (reversed) Intergenic