ID: 1203029333

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:560610-560632
Sequence GATACTCACTTTTTTGCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203029333_1203029340 27 Left 1203029333 16_KI270728v1_random:560610-560632 CCAATGGCAAAAAAGTGAGTATC No data
Right 1203029340 16_KI270728v1_random:560660-560682 CTGAGAAACCACTTTGTGATGGG No data
1203029333_1203029342 29 Left 1203029333 16_KI270728v1_random:560610-560632 CCAATGGCAAAAAAGTGAGTATC No data
Right 1203029342 16_KI270728v1_random:560662-560684 GAGAAACCACTTTGTGATGGGGG No data
1203029333_1203029338 0 Left 1203029333 16_KI270728v1_random:560610-560632 CCAATGGCAAAAAAGTGAGTATC No data
Right 1203029338 16_KI270728v1_random:560633-560655 CCAGGATAAAAATTAGAAGGAGG No data
1203029333_1203029335 -3 Left 1203029333 16_KI270728v1_random:560610-560632 CCAATGGCAAAAAAGTGAGTATC No data
Right 1203029335 16_KI270728v1_random:560630-560652 ATCCCAGGATAAAAATTAGAAGG No data
1203029333_1203029341 28 Left 1203029333 16_KI270728v1_random:560610-560632 CCAATGGCAAAAAAGTGAGTATC No data
Right 1203029341 16_KI270728v1_random:560661-560683 TGAGAAACCACTTTGTGATGGGG No data
1203029333_1203029339 26 Left 1203029333 16_KI270728v1_random:560610-560632 CCAATGGCAAAAAAGTGAGTATC No data
Right 1203029339 16_KI270728v1_random:560659-560681 TCTGAGAAACCACTTTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203029333 Original CRISPR GATACTCACTTTTTTGCCAT TGG (reversed) Intergenic