ID: 1203029336

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:560632-560654
Sequence CTCCTTCTAATTTTTATCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203029336_1203029340 5 Left 1203029336 16_KI270728v1_random:560632-560654 CCCAGGATAAAAATTAGAAGGAG No data
Right 1203029340 16_KI270728v1_random:560660-560682 CTGAGAAACCACTTTGTGATGGG No data
1203029336_1203029341 6 Left 1203029336 16_KI270728v1_random:560632-560654 CCCAGGATAAAAATTAGAAGGAG No data
Right 1203029341 16_KI270728v1_random:560661-560683 TGAGAAACCACTTTGTGATGGGG No data
1203029336_1203029339 4 Left 1203029336 16_KI270728v1_random:560632-560654 CCCAGGATAAAAATTAGAAGGAG No data
Right 1203029339 16_KI270728v1_random:560659-560681 TCTGAGAAACCACTTTGTGATGG No data
1203029336_1203029342 7 Left 1203029336 16_KI270728v1_random:560632-560654 CCCAGGATAAAAATTAGAAGGAG No data
Right 1203029342 16_KI270728v1_random:560662-560684 GAGAAACCACTTTGTGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203029336 Original CRISPR CTCCTTCTAATTTTTATCCT GGG (reversed) Intergenic