ID: 1203029337

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:560633-560655
Sequence CCTCCTTCTAATTTTTATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203029337_1203029341 5 Left 1203029337 16_KI270728v1_random:560633-560655 CCAGGATAAAAATTAGAAGGAGG No data
Right 1203029341 16_KI270728v1_random:560661-560683 TGAGAAACCACTTTGTGATGGGG No data
1203029337_1203029340 4 Left 1203029337 16_KI270728v1_random:560633-560655 CCAGGATAAAAATTAGAAGGAGG No data
Right 1203029340 16_KI270728v1_random:560660-560682 CTGAGAAACCACTTTGTGATGGG No data
1203029337_1203029342 6 Left 1203029337 16_KI270728v1_random:560633-560655 CCAGGATAAAAATTAGAAGGAGG No data
Right 1203029342 16_KI270728v1_random:560662-560684 GAGAAACCACTTTGTGATGGGGG No data
1203029337_1203029339 3 Left 1203029337 16_KI270728v1_random:560633-560655 CCAGGATAAAAATTAGAAGGAGG No data
Right 1203029339 16_KI270728v1_random:560659-560681 TCTGAGAAACCACTTTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203029337 Original CRISPR CCTCCTTCTAATTTTTATCC TGG (reversed) Intergenic