ID: 1203029340

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:560660-560682
Sequence CTGAGAAACCACTTTGTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203029337_1203029340 4 Left 1203029337 16_KI270728v1_random:560633-560655 CCAGGATAAAAATTAGAAGGAGG No data
Right 1203029340 16_KI270728v1_random:560660-560682 CTGAGAAACCACTTTGTGATGGG No data
1203029336_1203029340 5 Left 1203029336 16_KI270728v1_random:560632-560654 CCCAGGATAAAAATTAGAAGGAG No data
Right 1203029340 16_KI270728v1_random:560660-560682 CTGAGAAACCACTTTGTGATGGG No data
1203029333_1203029340 27 Left 1203029333 16_KI270728v1_random:560610-560632 CCAATGGCAAAAAAGTGAGTATC No data
Right 1203029340 16_KI270728v1_random:560660-560682 CTGAGAAACCACTTTGTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203029340 Original CRISPR CTGAGAAACCACTTTGTGAT GGG Intergenic