ID: 1203029708

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:565703-565725
Sequence CTGAGAAAACACTTTGTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203029704_1203029708 23 Left 1203029704 16_KI270728v1_random:565657-565679 CCAATGGCGAAAAAGCAAATATA No data
Right 1203029708 16_KI270728v1_random:565703-565725 CTGAGAAAACACTTTGTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203029708 Original CRISPR CTGAGAAAACACTTTGTGAT GGG Intergenic