ID: 1203032243 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16_KI270728v1_random:604628-604650 |
| Sequence | CTGAGAAATAACTTTGTGAT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1203032243_1203032247 | 27 | Left | 1203032243 | 16_KI270728v1_random:604628-604650 | CCTATCACAAAGTTATTTCTCAG | No data | ||
| Right | 1203032247 | 16_KI270728v1_random:604678-604700 | AATATTTACTTTTTCAACATTGG | No data | ||||
| 1203032243_1203032245 | 4 | Left | 1203032243 | 16_KI270728v1_random:604628-604650 | CCTATCACAAAGTTATTTCTCAG | No data | ||
| Right | 1203032245 | 16_KI270728v1_random:604655-604677 | CTTCCTGCTAATTTTTATCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1203032243 | Original CRISPR | CTGAGAAATAACTTTGTGAT AGG (reversed) | Intergenic | ||