ID: 1203032243

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:604628-604650
Sequence CTGAGAAATAACTTTGTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203032243_1203032247 27 Left 1203032243 16_KI270728v1_random:604628-604650 CCTATCACAAAGTTATTTCTCAG No data
Right 1203032247 16_KI270728v1_random:604678-604700 AATATTTACTTTTTCAACATTGG No data
1203032243_1203032245 4 Left 1203032243 16_KI270728v1_random:604628-604650 CCTATCACAAAGTTATTTCTCAG No data
Right 1203032245 16_KI270728v1_random:604655-604677 CTTCCTGCTAATTTTTATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203032243 Original CRISPR CTGAGAAATAACTTTGTGAT AGG (reversed) Intergenic