ID: 1203032245

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:604655-604677
Sequence CTTCCTGCTAATTTTTATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203032243_1203032245 4 Left 1203032243 16_KI270728v1_random:604628-604650 CCTATCACAAAGTTATTTCTCAG No data
Right 1203032245 16_KI270728v1_random:604655-604677 CTTCCTGCTAATTTTTATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203032245 Original CRISPR CTTCCTGCTAATTTTTATCT AGG Intergenic