ID: 1203032247

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:604678-604700
Sequence AATATTTACTTTTTCAACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203032244_1203032247 1 Left 1203032244 16_KI270728v1_random:604654-604676 CCTTCCTGCTAATTTTTATCTAG No data
Right 1203032247 16_KI270728v1_random:604678-604700 AATATTTACTTTTTCAACATTGG No data
1203032243_1203032247 27 Left 1203032243 16_KI270728v1_random:604628-604650 CCTATCACAAAGTTATTTCTCAG No data
Right 1203032247 16_KI270728v1_random:604678-604700 AATATTTACTTTTTCAACATTGG No data
1203032246_1203032247 -3 Left 1203032246 16_KI270728v1_random:604658-604680 CCTGCTAATTTTTATCTAGGAAT No data
Right 1203032247 16_KI270728v1_random:604678-604700 AATATTTACTTTTTCAACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203032247 Original CRISPR AATATTTACTTTTTCAACAT TGG Intergenic