ID: 1203034551

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:628433-628455
Sequence GCTGGCGGGGTGACGGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203034551_1203034559 8 Left 1203034551 16_KI270728v1_random:628433-628455 CCTGTGGCCGTCACCCCGCCAGC No data
Right 1203034559 16_KI270728v1_random:628464-628486 CCAGCCGCCACCTGACCACACGG No data
1203034551_1203034565 27 Left 1203034551 16_KI270728v1_random:628433-628455 CCTGTGGCCGTCACCCCGCCAGC No data
Right 1203034565 16_KI270728v1_random:628483-628505 ACGGGCCTCTGCTTGCTAGCCGG No data
1203034551_1203034560 9 Left 1203034551 16_KI270728v1_random:628433-628455 CCTGTGGCCGTCACCCCGCCAGC No data
Right 1203034560 16_KI270728v1_random:628465-628487 CAGCCGCCACCTGACCACACGGG No data
1203034551_1203034566 28 Left 1203034551 16_KI270728v1_random:628433-628455 CCTGTGGCCGTCACCCCGCCAGC No data
Right 1203034566 16_KI270728v1_random:628484-628506 CGGGCCTCTGCTTGCTAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203034551 Original CRISPR GCTGGCGGGGTGACGGCCAC AGG (reversed) Intergenic
No off target data available for this crispr