ID: 1203034553

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:628446-628468
Sequence GCTGGCAGTGTAGGCTGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203034553_1203034568 22 Left 1203034553 16_KI270728v1_random:628446-628468 CCCCGCCAGCCTACACTGCCAGC No data
Right 1203034568 16_KI270728v1_random:628491-628513 CTGCTTGCTAGCCGGGAGTGCGG No data
1203034553_1203034559 -5 Left 1203034553 16_KI270728v1_random:628446-628468 CCCCGCCAGCCTACACTGCCAGC No data
Right 1203034559 16_KI270728v1_random:628464-628486 CCAGCCGCCACCTGACCACACGG No data
1203034553_1203034560 -4 Left 1203034553 16_KI270728v1_random:628446-628468 CCCCGCCAGCCTACACTGCCAGC No data
Right 1203034560 16_KI270728v1_random:628465-628487 CAGCCGCCACCTGACCACACGGG No data
1203034553_1203034565 14 Left 1203034553 16_KI270728v1_random:628446-628468 CCCCGCCAGCCTACACTGCCAGC No data
Right 1203034565 16_KI270728v1_random:628483-628505 ACGGGCCTCTGCTTGCTAGCCGG No data
1203034553_1203034566 15 Left 1203034553 16_KI270728v1_random:628446-628468 CCCCGCCAGCCTACACTGCCAGC No data
Right 1203034566 16_KI270728v1_random:628484-628506 CGGGCCTCTGCTTGCTAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203034553 Original CRISPR GCTGGCAGTGTAGGCTGGCG GGG (reversed) Intergenic
No off target data available for this crispr