ID: 1203034554

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:628447-628469
Sequence GGCTGGCAGTGTAGGCTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 599
Summary {0: 5, 1: 3, 2: 2, 3: 48, 4: 541}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203034554_1203034560 -5 Left 1203034554 16_KI270728v1_random:628447-628469 CCCGCCAGCCTACACTGCCAGCC 0: 5
1: 3
2: 2
3: 48
4: 541
Right 1203034560 16_KI270728v1_random:628465-628487 CAGCCGCCACCTGACCACACGGG No data
1203034554_1203034565 13 Left 1203034554 16_KI270728v1_random:628447-628469 CCCGCCAGCCTACACTGCCAGCC 0: 5
1: 3
2: 2
3: 48
4: 541
Right 1203034565 16_KI270728v1_random:628483-628505 ACGGGCCTCTGCTTGCTAGCCGG No data
1203034554_1203034559 -6 Left 1203034554 16_KI270728v1_random:628447-628469 CCCGCCAGCCTACACTGCCAGCC 0: 5
1: 3
2: 2
3: 48
4: 541
Right 1203034559 16_KI270728v1_random:628464-628486 CCAGCCGCCACCTGACCACACGG No data
1203034554_1203034568 21 Left 1203034554 16_KI270728v1_random:628447-628469 CCCGCCAGCCTACACTGCCAGCC 0: 5
1: 3
2: 2
3: 48
4: 541
Right 1203034568 16_KI270728v1_random:628491-628513 CTGCTTGCTAGCCGGGAGTGCGG No data
1203034554_1203034566 14 Left 1203034554 16_KI270728v1_random:628447-628469 CCCGCCAGCCTACACTGCCAGCC 0: 5
1: 3
2: 2
3: 48
4: 541
Right 1203034566 16_KI270728v1_random:628484-628506 CGGGCCTCTGCTTGCTAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203034554 Original CRISPR GGCTGGCAGTGTAGGCTGGC GGG (reversed) Intergenic