ID: 1203034556

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:628451-628473
Sequence TGGCGGCTGGCAGTGTAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203034556_1203034568 17 Left 1203034556 16_KI270728v1_random:628451-628473 CCAGCCTACACTGCCAGCCGCCA No data
Right 1203034568 16_KI270728v1_random:628491-628513 CTGCTTGCTAGCCGGGAGTGCGG No data
1203034556_1203034559 -10 Left 1203034556 16_KI270728v1_random:628451-628473 CCAGCCTACACTGCCAGCCGCCA No data
Right 1203034559 16_KI270728v1_random:628464-628486 CCAGCCGCCACCTGACCACACGG No data
1203034556_1203034566 10 Left 1203034556 16_KI270728v1_random:628451-628473 CCAGCCTACACTGCCAGCCGCCA No data
Right 1203034566 16_KI270728v1_random:628484-628506 CGGGCCTCTGCTTGCTAGCCGGG No data
1203034556_1203034565 9 Left 1203034556 16_KI270728v1_random:628451-628473 CCAGCCTACACTGCCAGCCGCCA No data
Right 1203034565 16_KI270728v1_random:628483-628505 ACGGGCCTCTGCTTGCTAGCCGG No data
1203034556_1203034560 -9 Left 1203034556 16_KI270728v1_random:628451-628473 CCAGCCTACACTGCCAGCCGCCA No data
Right 1203034560 16_KI270728v1_random:628465-628487 CAGCCGCCACCTGACCACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203034556 Original CRISPR TGGCGGCTGGCAGTGTAGGC TGG (reversed) Intergenic