ID: 1203034557

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:628455-628477
Sequence CAGGTGGCGGCTGGCAGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203034557_1203034568 13 Left 1203034557 16_KI270728v1_random:628455-628477 CCTACACTGCCAGCCGCCACCTG No data
Right 1203034568 16_KI270728v1_random:628491-628513 CTGCTTGCTAGCCGGGAGTGCGG No data
1203034557_1203034566 6 Left 1203034557 16_KI270728v1_random:628455-628477 CCTACACTGCCAGCCGCCACCTG No data
Right 1203034566 16_KI270728v1_random:628484-628506 CGGGCCTCTGCTTGCTAGCCGGG No data
1203034557_1203034565 5 Left 1203034557 16_KI270728v1_random:628455-628477 CCTACACTGCCAGCCGCCACCTG No data
Right 1203034565 16_KI270728v1_random:628483-628505 ACGGGCCTCTGCTTGCTAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203034557 Original CRISPR CAGGTGGCGGCTGGCAGTGT AGG (reversed) Intergenic
No off target data available for this crispr