ID: 1203034558

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:628464-628486
Sequence CCGTGTGGTCAGGTGGCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203034558_1203034566 -3 Left 1203034558 16_KI270728v1_random:628464-628486 CCAGCCGCCACCTGACCACACGG No data
Right 1203034566 16_KI270728v1_random:628484-628506 CGGGCCTCTGCTTGCTAGCCGGG No data
1203034558_1203034568 4 Left 1203034558 16_KI270728v1_random:628464-628486 CCAGCCGCCACCTGACCACACGG No data
Right 1203034568 16_KI270728v1_random:628491-628513 CTGCTTGCTAGCCGGGAGTGCGG No data
1203034558_1203034565 -4 Left 1203034558 16_KI270728v1_random:628464-628486 CCAGCCGCCACCTGACCACACGG No data
Right 1203034565 16_KI270728v1_random:628483-628505 ACGGGCCTCTGCTTGCTAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203034558 Original CRISPR CCGTGTGGTCAGGTGGCGGC TGG (reversed) Intergenic
No off target data available for this crispr