ID: 1203034560

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:628465-628487
Sequence CAGCCGCCACCTGACCACAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203034556_1203034560 -9 Left 1203034556 16_KI270728v1_random:628451-628473 CCAGCCTACACTGCCAGCCGCCA No data
Right 1203034560 16_KI270728v1_random:628465-628487 CAGCCGCCACCTGACCACACGGG No data
1203034552_1203034560 2 Left 1203034552 16_KI270728v1_random:628440-628462 CCGTCACCCCGCCAGCCTACACT No data
Right 1203034560 16_KI270728v1_random:628465-628487 CAGCCGCCACCTGACCACACGGG No data
1203034549_1203034560 11 Left 1203034549 16_KI270728v1_random:628431-628453 CCCCTGTGGCCGTCACCCCGCCA No data
Right 1203034560 16_KI270728v1_random:628465-628487 CAGCCGCCACCTGACCACACGGG No data
1203034555_1203034560 -6 Left 1203034555 16_KI270728v1_random:628448-628470 CCGCCAGCCTACACTGCCAGCCG No data
Right 1203034560 16_KI270728v1_random:628465-628487 CAGCCGCCACCTGACCACACGGG No data
1203034547_1203034560 16 Left 1203034547 16_KI270728v1_random:628426-628448 CCCAGCCCCTGTGGCCGTCACCC No data
Right 1203034560 16_KI270728v1_random:628465-628487 CAGCCGCCACCTGACCACACGGG No data
1203034550_1203034560 10 Left 1203034550 16_KI270728v1_random:628432-628454 CCCTGTGGCCGTCACCCCGCCAG No data
Right 1203034560 16_KI270728v1_random:628465-628487 CAGCCGCCACCTGACCACACGGG No data
1203034545_1203034560 30 Left 1203034545 16_KI270728v1_random:628412-628434 CCACTGGTGTCAAACCCAGCCCC No data
Right 1203034560 16_KI270728v1_random:628465-628487 CAGCCGCCACCTGACCACACGGG No data
1203034553_1203034560 -4 Left 1203034553 16_KI270728v1_random:628446-628468 CCCCGCCAGCCTACACTGCCAGC No data
Right 1203034560 16_KI270728v1_random:628465-628487 CAGCCGCCACCTGACCACACGGG No data
1203034554_1203034560 -5 Left 1203034554 16_KI270728v1_random:628447-628469 CCCGCCAGCCTACACTGCCAGCC No data
Right 1203034560 16_KI270728v1_random:628465-628487 CAGCCGCCACCTGACCACACGGG No data
1203034548_1203034560 15 Left 1203034548 16_KI270728v1_random:628427-628449 CCAGCCCCTGTGGCCGTCACCCC No data
Right 1203034560 16_KI270728v1_random:628465-628487 CAGCCGCCACCTGACCACACGGG No data
1203034551_1203034560 9 Left 1203034551 16_KI270728v1_random:628433-628455 CCTGTGGCCGTCACCCCGCCAGC No data
Right 1203034560 16_KI270728v1_random:628465-628487 CAGCCGCCACCTGACCACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203034560 Original CRISPR CAGCCGCCACCTGACCACAC GGG Intergenic
No off target data available for this crispr