ID: 1203034561 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16_KI270728v1_random:628468-628490 |
Sequence | AGGCCCGTGTGGTCAGGTGG CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1203034561_1203034568 | 0 | Left | 1203034561 | 16_KI270728v1_random:628468-628490 | CCGCCACCTGACCACACGGGCCT | No data | ||
Right | 1203034568 | 16_KI270728v1_random:628491-628513 | CTGCTTGCTAGCCGGGAGTGCGG | No data | ||||
1203034561_1203034566 | -7 | Left | 1203034561 | 16_KI270728v1_random:628468-628490 | CCGCCACCTGACCACACGGGCCT | No data | ||
Right | 1203034566 | 16_KI270728v1_random:628484-628506 | CGGGCCTCTGCTTGCTAGCCGGG | No data | ||||
1203034561_1203034565 | -8 | Left | 1203034561 | 16_KI270728v1_random:628468-628490 | CCGCCACCTGACCACACGGGCCT | No data | ||
Right | 1203034565 | 16_KI270728v1_random:628483-628505 | ACGGGCCTCTGCTTGCTAGCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1203034561 | Original CRISPR | AGGCCCGTGTGGTCAGGTGG CGG (reversed) | Intergenic | ||