ID: 1203034562

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:628471-628493
Sequence CAGAGGCCCGTGTGGTCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203034562_1203034571 28 Left 1203034562 16_KI270728v1_random:628471-628493 CCACCTGACCACACGGGCCTCTG No data
Right 1203034571 16_KI270728v1_random:628522-628544 TTCCCAGCTCAGTGCCAAAGAGG No data
1203034562_1203034568 -3 Left 1203034562 16_KI270728v1_random:628471-628493 CCACCTGACCACACGGGCCTCTG No data
Right 1203034568 16_KI270728v1_random:628491-628513 CTGCTTGCTAGCCGGGAGTGCGG No data
1203034562_1203034572 29 Left 1203034562 16_KI270728v1_random:628471-628493 CCACCTGACCACACGGGCCTCTG No data
Right 1203034572 16_KI270728v1_random:628523-628545 TCCCAGCTCAGTGCCAAAGAGGG No data
1203034562_1203034574 30 Left 1203034562 16_KI270728v1_random:628471-628493 CCACCTGACCACACGGGCCTCTG No data
Right 1203034574 16_KI270728v1_random:628524-628546 CCCAGCTCAGTGCCAAAGAGGGG No data
1203034562_1203034566 -10 Left 1203034562 16_KI270728v1_random:628471-628493 CCACCTGACCACACGGGCCTCTG No data
Right 1203034566 16_KI270728v1_random:628484-628506 CGGGCCTCTGCTTGCTAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203034562 Original CRISPR CAGAGGCCCGTGTGGTCAGG TGG (reversed) Intergenic