ID: 1203034563

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:628474-628496
Sequence AAGCAGAGGCCCGTGTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203034563_1203034574 27 Left 1203034563 16_KI270728v1_random:628474-628496 CCTGACCACACGGGCCTCTGCTT No data
Right 1203034574 16_KI270728v1_random:628524-628546 CCCAGCTCAGTGCCAAAGAGGGG No data
1203034563_1203034568 -6 Left 1203034563 16_KI270728v1_random:628474-628496 CCTGACCACACGGGCCTCTGCTT No data
Right 1203034568 16_KI270728v1_random:628491-628513 CTGCTTGCTAGCCGGGAGTGCGG No data
1203034563_1203034571 25 Left 1203034563 16_KI270728v1_random:628474-628496 CCTGACCACACGGGCCTCTGCTT No data
Right 1203034571 16_KI270728v1_random:628522-628544 TTCCCAGCTCAGTGCCAAAGAGG No data
1203034563_1203034572 26 Left 1203034563 16_KI270728v1_random:628474-628496 CCTGACCACACGGGCCTCTGCTT No data
Right 1203034572 16_KI270728v1_random:628523-628545 TCCCAGCTCAGTGCCAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203034563 Original CRISPR AAGCAGAGGCCCGTGTGGTC AGG (reversed) Intergenic
No off target data available for this crispr