ID: 1203034566

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:628484-628506
Sequence CGGGCCTCTGCTTGCTAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203034549_1203034566 30 Left 1203034549 16_KI270728v1_random:628431-628453 CCCCTGTGGCCGTCACCCCGCCA No data
Right 1203034566 16_KI270728v1_random:628484-628506 CGGGCCTCTGCTTGCTAGCCGGG No data
1203034562_1203034566 -10 Left 1203034562 16_KI270728v1_random:628471-628493 CCACCTGACCACACGGGCCTCTG No data
Right 1203034566 16_KI270728v1_random:628484-628506 CGGGCCTCTGCTTGCTAGCCGGG No data
1203034558_1203034566 -3 Left 1203034558 16_KI270728v1_random:628464-628486 CCAGCCGCCACCTGACCACACGG No data
Right 1203034566 16_KI270728v1_random:628484-628506 CGGGCCTCTGCTTGCTAGCCGGG No data
1203034557_1203034566 6 Left 1203034557 16_KI270728v1_random:628455-628477 CCTACACTGCCAGCCGCCACCTG No data
Right 1203034566 16_KI270728v1_random:628484-628506 CGGGCCTCTGCTTGCTAGCCGGG No data
1203034551_1203034566 28 Left 1203034551 16_KI270728v1_random:628433-628455 CCTGTGGCCGTCACCCCGCCAGC No data
Right 1203034566 16_KI270728v1_random:628484-628506 CGGGCCTCTGCTTGCTAGCCGGG No data
1203034553_1203034566 15 Left 1203034553 16_KI270728v1_random:628446-628468 CCCCGCCAGCCTACACTGCCAGC No data
Right 1203034566 16_KI270728v1_random:628484-628506 CGGGCCTCTGCTTGCTAGCCGGG No data
1203034550_1203034566 29 Left 1203034550 16_KI270728v1_random:628432-628454 CCCTGTGGCCGTCACCCCGCCAG No data
Right 1203034566 16_KI270728v1_random:628484-628506 CGGGCCTCTGCTTGCTAGCCGGG No data
1203034554_1203034566 14 Left 1203034554 16_KI270728v1_random:628447-628469 CCCGCCAGCCTACACTGCCAGCC No data
Right 1203034566 16_KI270728v1_random:628484-628506 CGGGCCTCTGCTTGCTAGCCGGG No data
1203034555_1203034566 13 Left 1203034555 16_KI270728v1_random:628448-628470 CCGCCAGCCTACACTGCCAGCCG No data
Right 1203034566 16_KI270728v1_random:628484-628506 CGGGCCTCTGCTTGCTAGCCGGG No data
1203034552_1203034566 21 Left 1203034552 16_KI270728v1_random:628440-628462 CCGTCACCCCGCCAGCCTACACT No data
Right 1203034566 16_KI270728v1_random:628484-628506 CGGGCCTCTGCTTGCTAGCCGGG No data
1203034556_1203034566 10 Left 1203034556 16_KI270728v1_random:628451-628473 CCAGCCTACACTGCCAGCCGCCA No data
Right 1203034566 16_KI270728v1_random:628484-628506 CGGGCCTCTGCTTGCTAGCCGGG No data
1203034561_1203034566 -7 Left 1203034561 16_KI270728v1_random:628468-628490 CCGCCACCTGACCACACGGGCCT No data
Right 1203034566 16_KI270728v1_random:628484-628506 CGGGCCTCTGCTTGCTAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203034566 Original CRISPR CGGGCCTCTGCTTGCTAGCC GGG Intergenic
No off target data available for this crispr