ID: 1203034567

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:628488-628510
Sequence CACTCCCGGCTAGCAAGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203034567_1203034571 11 Left 1203034567 16_KI270728v1_random:628488-628510 CCTCTGCTTGCTAGCCGGGAGTG No data
Right 1203034571 16_KI270728v1_random:628522-628544 TTCCCAGCTCAGTGCCAAAGAGG No data
1203034567_1203034577 24 Left 1203034567 16_KI270728v1_random:628488-628510 CCTCTGCTTGCTAGCCGGGAGTG No data
Right 1203034577 16_KI270728v1_random:628535-628557 GCCAAAGAGGGGTCACCAGGCGG No data
1203034567_1203034574 13 Left 1203034567 16_KI270728v1_random:628488-628510 CCTCTGCTTGCTAGCCGGGAGTG No data
Right 1203034574 16_KI270728v1_random:628524-628546 CCCAGCTCAGTGCCAAAGAGGGG No data
1203034567_1203034572 12 Left 1203034567 16_KI270728v1_random:628488-628510 CCTCTGCTTGCTAGCCGGGAGTG No data
Right 1203034572 16_KI270728v1_random:628523-628545 TCCCAGCTCAGTGCCAAAGAGGG No data
1203034567_1203034576 21 Left 1203034567 16_KI270728v1_random:628488-628510 CCTCTGCTTGCTAGCCGGGAGTG No data
Right 1203034576 16_KI270728v1_random:628532-628554 AGTGCCAAAGAGGGGTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203034567 Original CRISPR CACTCCCGGCTAGCAAGCAG AGG (reversed) Intergenic