ID: 1203034568

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:628491-628513
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203034561_1203034568 0 Left 1203034561 16_KI270728v1_random:628468-628490 CCGCCACCTGACCACACGGGCCT No data
Right 1203034568 16_KI270728v1_random:628491-628513 CTGCTTGCTAGCCGGGAGTGCGG No data
1203034556_1203034568 17 Left 1203034556 16_KI270728v1_random:628451-628473 CCAGCCTACACTGCCAGCCGCCA No data
Right 1203034568 16_KI270728v1_random:628491-628513 CTGCTTGCTAGCCGGGAGTGCGG No data
1203034563_1203034568 -6 Left 1203034563 16_KI270728v1_random:628474-628496 CCTGACCACACGGGCCTCTGCTT No data
Right 1203034568 16_KI270728v1_random:628491-628513 CTGCTTGCTAGCCGGGAGTGCGG No data
1203034554_1203034568 21 Left 1203034554 16_KI270728v1_random:628447-628469 CCCGCCAGCCTACACTGCCAGCC 0: 5
1: 3
2: 2
3: 48
4: 541
Right 1203034568 16_KI270728v1_random:628491-628513 CTGCTTGCTAGCCGGGAGTGCGG No data
1203034552_1203034568 28 Left 1203034552 16_KI270728v1_random:628440-628462 CCGTCACCCCGCCAGCCTACACT No data
Right 1203034568 16_KI270728v1_random:628491-628513 CTGCTTGCTAGCCGGGAGTGCGG No data
1203034557_1203034568 13 Left 1203034557 16_KI270728v1_random:628455-628477 CCTACACTGCCAGCCGCCACCTG No data
Right 1203034568 16_KI270728v1_random:628491-628513 CTGCTTGCTAGCCGGGAGTGCGG No data
1203034562_1203034568 -3 Left 1203034562 16_KI270728v1_random:628471-628493 CCACCTGACCACACGGGCCTCTG No data
Right 1203034568 16_KI270728v1_random:628491-628513 CTGCTTGCTAGCCGGGAGTGCGG No data
1203034558_1203034568 4 Left 1203034558 16_KI270728v1_random:628464-628486 CCAGCCGCCACCTGACCACACGG No data
Right 1203034568 16_KI270728v1_random:628491-628513 CTGCTTGCTAGCCGGGAGTGCGG No data
1203034553_1203034568 22 Left 1203034553 16_KI270728v1_random:628446-628468 CCCCGCCAGCCTACACTGCCAGC No data
Right 1203034568 16_KI270728v1_random:628491-628513 CTGCTTGCTAGCCGGGAGTGCGG No data
1203034555_1203034568 20 Left 1203034555 16_KI270728v1_random:628448-628470 CCGCCAGCCTACACTGCCAGCCG No data
Right 1203034568 16_KI270728v1_random:628491-628513 CTGCTTGCTAGCCGGGAGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203034568 Original CRISPR CTGCTTGCTAGCCGGGAGTG CGG Intergenic