ID: 1203034569

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:628502-628524
Sequence GAACATGGTGTCCGCACTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203034569_1203034572 -2 Left 1203034569 16_KI270728v1_random:628502-628524 CCGGGAGTGCGGACACCATGTTC No data
Right 1203034572 16_KI270728v1_random:628523-628545 TCCCAGCTCAGTGCCAAAGAGGG No data
1203034569_1203034574 -1 Left 1203034569 16_KI270728v1_random:628502-628524 CCGGGAGTGCGGACACCATGTTC No data
Right 1203034574 16_KI270728v1_random:628524-628546 CCCAGCTCAGTGCCAAAGAGGGG No data
1203034569_1203034576 7 Left 1203034569 16_KI270728v1_random:628502-628524 CCGGGAGTGCGGACACCATGTTC No data
Right 1203034576 16_KI270728v1_random:628532-628554 AGTGCCAAAGAGGGGTCACCAGG No data
1203034569_1203034571 -3 Left 1203034569 16_KI270728v1_random:628502-628524 CCGGGAGTGCGGACACCATGTTC No data
Right 1203034571 16_KI270728v1_random:628522-628544 TTCCCAGCTCAGTGCCAAAGAGG No data
1203034569_1203034577 10 Left 1203034569 16_KI270728v1_random:628502-628524 CCGGGAGTGCGGACACCATGTTC No data
Right 1203034577 16_KI270728v1_random:628535-628557 GCCAAAGAGGGGTCACCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203034569 Original CRISPR GAACATGGTGTCCGCACTCC CGG (reversed) Intergenic
No off target data available for this crispr