ID: 1203034571 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16_KI270728v1_random:628522-628544 |
Sequence | TTCCCAGCTCAGTGCCAAAG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 5 Related Crispr Pairs
Show Crispr PairsNote: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1203034571 | Original CRISPR | TTCCCAGCTCAGTGCCAAAG AGG | Intergenic | ||