ID: 1203034572

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:628523-628545
Sequence TCCCAGCTCAGTGCCAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203034569_1203034572 -2 Left 1203034569 16_KI270728v1_random:628502-628524 CCGGGAGTGCGGACACCATGTTC No data
Right 1203034572 16_KI270728v1_random:628523-628545 TCCCAGCTCAGTGCCAAAGAGGG No data
1203034564_1203034572 21 Left 1203034564 16_KI270728v1_random:628479-628501 CCACACGGGCCTCTGCTTGCTAG No data
Right 1203034572 16_KI270728v1_random:628523-628545 TCCCAGCTCAGTGCCAAAGAGGG No data
1203034562_1203034572 29 Left 1203034562 16_KI270728v1_random:628471-628493 CCACCTGACCACACGGGCCTCTG No data
Right 1203034572 16_KI270728v1_random:628523-628545 TCCCAGCTCAGTGCCAAAGAGGG No data
1203034567_1203034572 12 Left 1203034567 16_KI270728v1_random:628488-628510 CCTCTGCTTGCTAGCCGGGAGTG No data
Right 1203034572 16_KI270728v1_random:628523-628545 TCCCAGCTCAGTGCCAAAGAGGG No data
1203034563_1203034572 26 Left 1203034563 16_KI270728v1_random:628474-628496 CCTGACCACACGGGCCTCTGCTT No data
Right 1203034572 16_KI270728v1_random:628523-628545 TCCCAGCTCAGTGCCAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203034572 Original CRISPR TCCCAGCTCAGTGCCAAAGA GGG Intergenic
No off target data available for this crispr