ID: 1203034576

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:628532-628554
Sequence AGTGCCAAAGAGGGGTCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203034570_1203034576 -8 Left 1203034570 16_KI270728v1_random:628517-628539 CCATGTTCCCAGCTCAGTGCCAA No data
Right 1203034576 16_KI270728v1_random:628532-628554 AGTGCCAAAGAGGGGTCACCAGG No data
1203034564_1203034576 30 Left 1203034564 16_KI270728v1_random:628479-628501 CCACACGGGCCTCTGCTTGCTAG No data
Right 1203034576 16_KI270728v1_random:628532-628554 AGTGCCAAAGAGGGGTCACCAGG No data
1203034569_1203034576 7 Left 1203034569 16_KI270728v1_random:628502-628524 CCGGGAGTGCGGACACCATGTTC No data
Right 1203034576 16_KI270728v1_random:628532-628554 AGTGCCAAAGAGGGGTCACCAGG No data
1203034567_1203034576 21 Left 1203034567 16_KI270728v1_random:628488-628510 CCTCTGCTTGCTAGCCGGGAGTG No data
Right 1203034576 16_KI270728v1_random:628532-628554 AGTGCCAAAGAGGGGTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203034576 Original CRISPR AGTGCCAAAGAGGGGTCACC AGG Intergenic
No off target data available for this crispr