ID: 1203034625

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:628724-628746
Sequence CTGCGGGTCTTGGGGTGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203034618_1203034625 3 Left 1203034618 16_KI270728v1_random:628698-628720 CCTGCCTCAGAGTCTGGTGGTGT No data
Right 1203034625 16_KI270728v1_random:628724-628746 CTGCGGGTCTTGGGGTGAGATGG No data
1203034619_1203034625 -1 Left 1203034619 16_KI270728v1_random:628702-628724 CCTCAGAGTCTGGTGGTGTCTGC No data
Right 1203034625 16_KI270728v1_random:628724-628746 CTGCGGGTCTTGGGGTGAGATGG No data
1203034617_1203034625 4 Left 1203034617 16_KI270728v1_random:628697-628719 CCCTGCCTCAGAGTCTGGTGGTG No data
Right 1203034625 16_KI270728v1_random:628724-628746 CTGCGGGTCTTGGGGTGAGATGG No data
1203034615_1203034625 7 Left 1203034615 16_KI270728v1_random:628694-628716 CCTCCCTGCCTCAGAGTCTGGTG No data
Right 1203034625 16_KI270728v1_random:628724-628746 CTGCGGGTCTTGGGGTGAGATGG No data
1203034613_1203034625 11 Left 1203034613 16_KI270728v1_random:628690-628712 CCTTCCTCCCTGCCTCAGAGTCT No data
Right 1203034625 16_KI270728v1_random:628724-628746 CTGCGGGTCTTGGGGTGAGATGG No data
1203034612_1203034625 28 Left 1203034612 16_KI270728v1_random:628673-628695 CCATTGGCAAATGCAGTCCTTCC No data
Right 1203034625 16_KI270728v1_random:628724-628746 CTGCGGGTCTTGGGGTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203034625 Original CRISPR CTGCGGGTCTTGGGGTGAGA TGG Intergenic
No off target data available for this crispr