ID: 1203042456 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16_KI270728v1_random:774963-774985 |
| Sequence | ATGAGAAATCACTTTGTGAT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1203042456_1203042458 | 5 | Left | 1203042456 | 16_KI270728v1_random:774963-774985 | CCCATCACAAAGTGATTTCTCAT | No data | ||
| Right | 1203042458 | 16_KI270728v1_random:774991-775013 | TTCCTTCTAGTTTTTATCCTTGG | No data | ||||
| 1203042456_1203042461 | 24 | Left | 1203042456 | 16_KI270728v1_random:774963-774985 | CCCATCACAAAGTGATTTCTCAT | No data | ||
| Right | 1203042461 | 16_KI270728v1_random:775010-775032 | TTGGATATTCACTTCACCATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1203042456 | Original CRISPR | ATGAGAAATCACTTTGTGAT GGG (reversed) | Intergenic | ||